Thursday, April 1, 2010

Akademia: Jujukan (Sequence) DNA!

Kat dalam blog ni dah ada segmen Etika, Kisah Multicultural dan OhSoRandom. Now, I proudly announce a new segment; Akademia. Githoo. (tak tahulah kenapa gedik sangat hari ni). Apa yang boleh diharap (expect) dari segment ni adalah celoteh pasal benda-benda yang berkaitan akademik, dari perspektif seutas benang yang basah. Kaann...

Mungkin u ols tahu yang CB balik kampung korek tanah-tangkap cacing-awet-ambik gambar-klon-jujukan (sequence). Semua orang teruja ni dengan hasil kajian (gempak githoo) yang CB buat ni. Berikut dipaparkan jujukan DNA yang CB dapat daripada komuniti cacing di sebuah negeri pantai timur.

GCTACCTTGTTACGACTTTTGCCCGGTTCAAGCCGCTGCGATTAAAACGG
TTTCCACAAGCGGAAAGCCCGTGAGAGCCAAACGCCTACGGTCCCCGTTC
TTCTCGAAACGGCTCAGTCCCGGGCAGCGACGGGCGGTGTGTACAAAGGG
CAGGGACGTAATCAACGCGAGCTTATGACCCGCACTTACTGGGAATTCCT
CGTTCAAGGGAAATAATTGCAAGTCCCTATCCCAATCACGAAAGGTTTTA
AGCGGGTTACCCAGCTCTTTCGAGCAAGGTGAACTAGCACTCTGCACCTT
TCAGTGTAGCGCGCGTGCAGCCCCGGACATCTAAGGGCATCACAGACCTG
TTATTGCTCCTTCTCATGCGGCTGAACACCGCTTGTCCCTCTAAGAAGTA
GCGTGCACCGAAAGATACACGTACTAGTTAGCAGGCTGGAGTCTCGTTCG
TTATCGGAATAAACCAGACAAATCGCTCCACCAACTAAGAACGGCCATGC
ACCACCACCCACCGAATCAAGAAAGAGCTCTCGATCTGTCAATCCTTACA
GTGTCCGGGCCGGGTGAGTTTTCCCGTGTTGAGTCAAATTAAGCCGCAGG
CTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGATTTG
CAACCATACTTCCCCCGGAACCGGAAGACTTTCGTTTCCGGGAAGCTCCC
CGTTGGGTCATTTCTAACACCAACGGATCGCTAGTTGGTATCGTTTACGG
TTAGAACTAGGGCGGTATCTGATCGCCTTCGAACCTCTAACTTTCGTTCT
TGATTAATGAAAACATTCTTGGCAAATGCTTTCGCAGTAGTACGTCTTGC
GACGATCCAAGAATTTCACCTCTAACGTCGCAATACGAATGCCCCCGTCT
GTCCCTCTTAATCATTATCTCCCGTTCCGAAAGCCAACAAAATAGAACCG
AGATCCTATTCTATTATTCCATGCAACAGTATACAGGCAAAAGACGCCTG
TTTTGAGCACTCTAATTTTTTCAAAGTAAACTCGCTAGCCACCAACTGGC
ACCCAATTAAGGGCACCAATGGCAAACCAGCCAACAAAGTGCCGTAGAAC
AGTTCGCACCACGTGGGTGGACCGCCTACTGGGCACGCAGATCCAACTAC
GAGCTTTTTAACCGCAGCAGCATAGATATACACCTGCGGAGCTGGAATTA
CCGCGGCTGCTGGCACCAGACTTGCCCTCCGCTAGATCCTCGTTAAAGGG
TTTAGATTGTACTCATTCCGATGACGGCACTCAAAGAGAGCCGTCTCGTT
ATTTTTCGTCACTACCTCCTCGTGCTGAGAGTGGGTAATTTGCGCGCCTG
CTGCCTTCCTTAGAAGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAGTC
GAACCCTTATTCTCCGTTACCCGTTACAACCATGGTAGGCACGTAAACTA
CCATCGAAAGTTGATAAGGCAGACACTTGAAAGATGCGGCGTCGGTACTA
GGACCAATACGCTCAGCTGAGTTATTCAGATTCGCCAGACGGACGGCCGA
AGCCGATTGGCTTTGTTCTAATAAATGCGCTCGTCCCGTAAGGTCGGAGC
TTGATTGCGTGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAAAAGA
GGAGATCCAAGAAACAACGGCTGTTGTAATGAGCTATTCGCGGCTTCACT
TTAGAATTAGTTTATGCTTAGACATGCATGGCTTAATCTTGAG
Cantik kan? Marvelous bak kata penyelia CB. Nampak macam  bercahaya dan penuh keimanan gittew.
Kalau tengok betul-betul kita boleh lihat bahawa deretan T dan G seolah-olah menyundal dan bertepuk-tampar sesama jenis mereka. Sosial sangat tau!

Sashay, away.

4 comments:

aiXat.MR said...

oh, bagus2.
Tahniah la anyway.
=)

ble habis master ko ni nyah?

~~DucKneSs~~ said...

uhhhh..

segmen ni la yang paling xbest sekali..

saya mo cadangkan pada pihak pentadbir supaya kurangkan bajet utk ruangan2 seperti ini..sekian terima kasih.. :)

Cik Benang said...

Aixat:
Thanx mate. InsyaALLAH September ni.
:)

Duckness:
Tak best ke u ols? Nanti CB bawak ke mesyuarat Persatuan Ibu Ayam dan Sundal-sundal. LOL!

~~DucKneSs~~ said...

hahhahaha..say GOODBYE TO THE SEGMENT..hahahaha